Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1015
Length(NT) : 1298
Best Gene Model Blast : Link to GSTUMT00006769001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein BC1G_07251
Accession: ref|XP_001554114.1| Score: 217 E_value: 1e-15
KEGG Definition: hypothetical protein
Accession: mgr:MGG_01578 Score: 191 E_value: 6e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1015
TTGGAAGCTTGTGGTCTGGTTGATATTTGCACTATGCCCATGGCTAGGCC
GTCTTGGAGACTGGATGCTGGCTTGGACTGAGGGGGACAAGAGACTCCAG
GTTTTTTTTGTTATGTTTTTCTTTCCATTGGTCATGAATGCGATGCAATA
CTACATTATCGATTCATACATCAAGAACAGGAATCCTTCGCACACTGCAC
TACAAGACTCTCCTCCTGTTTCGGGACGACGGGTATCTTCGACATCAATG
CGGTTCTCATTCGATAGTTCCAATGATGTGTTTTCCTCAGACGAGGATGA
AGCCTCTGGTTCGAGACACCTTCTGCAGCCCTCTTCCAATAGGACTCGCC
GAGGTCACCGCAAGGTGAACAAATCACCCACTCCGGTGGTAGAAGAATAC
AATCCGGACACGGATGGCTCCACCCTTCAAGATGGCCCGGATGATATACC
ACACTCCGAATCCCCATCCCCAACCTCGTTCCAGGCGCTGAGAAATGGAA
GAAAGGGCCTCGGCGGAAAAGGGGTTGGCGCGGAGAGCAGCAAAAGCATG
AATAGTTCGATGATGCTATTACCCGGCAGCAGAGGTCCAAGCACCCCTGG
CTATGGCGAGGAGGAGAGTGCAGGGAGTGCAGGGAGAGGTTTCGGAGGAA
GAAGAGGGAGCGATCTAGATGATGATTCAACATTAATCGAGCCGGAGGAC
GACCTGGGAAGGGGCAGCAGGTAAAGTAACTGACGGGAGTCGCCTTGGCT
AGGAACTTAGATTATGAACTGTTATTTCTCTTCTCATTGATATAAACCAA
CGGTGAGGCATCGCTAGGAAATGTCAGGGGTTTTCGAGCAGACCTATGAG
CTTTTGAAGCCCCATTTTTCTGTTCGCTCGCTCTGAGCTTTACCCTTTCA
TTTCCCGCCAGACATGACCATTTCCTTACCAACCGGGAGACAAACGAACA
TACCATCTCCCGAGGCGCACATTTCCCTTGTTTCTTGGCAGTATATGTAT
TTGAGTTTTCAGCCAGTCCTTGCATTCGAGTGTTTATTATATTTATCAGC
AAACGGAGTTGGGGCGATTGGTAGAGCTTTTTTTCCGTTTTTTTTTTTTT
ATACTTTCTGTGTCTTTTTAGTTTTTAGTTTTTGTGAATGCGATTTGCTT
TGCGGAATAGTGGACTGTATTATTCTATTGAGTCGGGGGCAGAAGTGGGA
TGGAGAATAAATACATGGGAGGTTTCCGGATAATAGGAAAAGTGTTTCCC
TCTAAGGCGAGGACTAGGTTGAAGTGGTAGTATTATTAACTTATAGTG

Sequences in the Contig:

SY0AAA30YC12FM1 SY0AAA3YJ15FM1 SY0AAC49YA23FM1
SY0AAD7YI13FM1