Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1013
Length(NT) : 1371
Best Gene Model Blast : Link to GSTUMT00007244001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_08872
Accession: ref|XP_001590108.1| Score: 1714 E_value: 0.0
KEGG Definition: dihydroxy-acid dehydratase [EC:4.2.1.9]; K01687 dihydroxy-acid dehydratase
Accession: aor:AO090009000414 Score: 1684 E_value: 0.0
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG2448 Score: 1691 E_value: 0.0
PFAM Definition: ILVD_EDD, Dehydratase family..
Pfam Number: pfam00920 Score: 1500 E_value: 1e-167
Swissprot: Q10318|ILV3_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig1013
TTGGCGACAGTACTCGACCTCGGCAAGACTGTAAAGGAAGGTCTAGAGAA
GATCGGCATGATTGGTTGGCAATTCAACACCATTGGGGTTTCAGATGCCA
TTACCATGAGCAACCAAGGAATGAGGTTCTCGTTGCAAAGCAGAGATATT
ATCGCCGATTCCATCGAAACAACTACTTGTGCTCAGCATCATGATGCGAA
CATCTCCATCCCCGGATGTGACAAGAACATGCCTGGATGCATCATGGCCA
TGGCCCGACACAACCGACCGTCGATCATGATCTACGGTGGCTCTATAAAG
GGAGGTTATTCCGAACGCCTCCGCCAGCCAGTCAACATCTCAAGCTGTTT
TGAAGCCCACGGTGCCCTCATGTACGGTAAGGTCTCGGAGGCTGACCTCG
ACGATGTCGTTAGGCACGCTTGCCCCGGTCCCGGTGGTTGTGGAGGCATG
TATACGGCCAACACGATGGCTACGGCAATCGAGGCCATGGGTCTCACGCT
TCCCGGATCTTCTACTACGCCTGCCGAATCTCCCGCGAAGATGAGAGAAT
GTCTCCGGGTCTCTGAAGCTATCAGAATTTGTCTGGAAAGGGATATTAAG
CCCCGCGATTTGATAACTCGGGAGTCTTTCGAAAATGCTATGGTTGTGAC
GATAATAATGGGGGGATCCACGAACGCCGTTCTCCATTTCCTTGCAATTT
CCCATACTACCGACCTGGATTTAACCATCGATGACTTTCAGAGAGTCTCC
GACAAGATTCCGTATTTGGCAGATCTCAAGCCCTCTGGAAAGTACATGGT
GGCCGACCTCGCTGAAATTGGCGGCATGCCGTCGGTTCTCAAATTCTTGA
TTCATGCCAGTCTCGTCAATGGAGATATCCCGACCGTTACTGGCAAAACA
CTTAGGGAAAACTGCGAGCCTGCACCAAGTCTCGACCCAGGGCAAGATAT
TATCAGACCTCTTAGCAACCCAATCAAGTCGAGCGGCCATATTCGAATTC
TGAAGGGAAACTTGGCACCTGGTGGAGCGGTTGCCAAAATCACCGGGAAA
GAGGGTAAAGTATTTGTCGGAAAGGCTCGAGTCTATGACGGCGAGCCAGC
CCTAATCTCCAGTTTGGAAAAAGGGGAGATTAAGCCAGGTGAGAATACTG
TGCTTTGCGTAAGGTATGAAGGGCCGAAGGGTGGCCCCGGTATGCCGGAG
CAACTAAAGACAAGTGCAGTGCTCATGGGTGCGGGCCTTCGCAACGTGGC
TCTGATTACAGACGGACGCTATAGTGGTGCTTCACATGGATTTATCGTCG
GCCACATAGTGCCTGAAGCCCAAGTTGGTGGCCCAATCGCTATCCTAAAA
GACGGGGATATCGTCGCTATC

Sequences in the Contig:

SY0AAA3YJ03FM1 SY0AAA63YF05FM1 SY0AAD36YD05FM1