Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1012
Length(NT) : 1906
Best Gene Model Blast : Link to GSTUMT00002312001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: hypothetical protein SNOG_02704
Accession: ref|XP_001793302.1| Score: 1029 E_value: 1e-109
KEGG Definition: Patatin-like serine hydrolase, putative
Accession: afm:AFUA_2G07870 Score: 363 E_value: 1e-32
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG4231 Score: 167 E_value: 3e-12
PFAM Definition: Patatin, Patatin-like phospholipase. This family consists of various patatin glycoproteins from plants. The patatin protein accounts for up to 40% of the total soluble protein in potato tubers. Patatin is a storage protein but it also has the enzymatic activity of lipid acyl hydrolase, catalysing the cleavage of fatty acids from membrane lipids. Members of this family have been found also in vertebrates..
Pfam Number: pfam01734 Score: 158 E_value: 3e-11
Swissprot: Q5XTS1|PLPL8_RABIT
Gene Ontology:
GO:0004622 = Molecular function: lysophospholipase activity

Sequence:
>Contig1012
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGTTATCGCACGCAATGGCC
GAGTCAAATCTACCACCACTTAGAATCCTCTCGCTTGATGGCGGGGGAGT
CCGCGGATTGAGCTCGCTGATGATCTTACAGGACATTATGAGCACCATAT
CGCAGCAGGAGAAATCTTCGCATATTCGCCCAAAGGACGATGACACGCCA
TTGAAGCCGTGCGAATACTTTGACATCATCGGCGGGACATCTACCGGTGG
AATTATTGCCATTTTACTCTCCCGTTTGCGCCTGGACGTACCGGCATGTA
TAGATATCTACACTCAGTTAGCGGAGGAAATATTCAGCAAAGACCGTTCA
ATCAAGATATTTGGAACGCCGCTCCGATTTGCGGGGGCTCGATTCTCAGG
GGCAGTATTGGAGAAAGCTATCAAGCGGGTGTTGGTCGAGAATAGCTTCG
ACCCGGAGGAGAAAATGTTCGACGAGACGCTCACGCTACGTGAGAAGGAA
ATCCGTCGTCGAGTGGATACCGGCCAACTCACAAAACTAGAAGTAACCCA
TAGTGGGGGTGTCCGGGATGTAATCGAGAAGAAAACCTGGCGAACGTCTA
CAAATAGCAATTTCTCCCTCAAACCCGCACAGGATTCTAAGCCAGATCCA
AACACCCACAGTCCACAAACCCCCAAGCCGGGCTGTCATGGCATCGTGGT
CGCAGTCTACAAACACGCCGTTGGCGTACCGAAACTGTTTCACACAAACG
ATCCCGACGATCGTAAAACTAAAATCTGGCAGGCCCTCCGAGCGACCTCG
GCAGCCCCCACCTTTTTTGACGAGATCACGTTCGGCACGCCCAAGATCAC
CTACATTGACGGCGGTCTCGGTTATAACTCCCCGTGCGCCGAAATCGATT
TTGAGGCCAAAACCCGCTGGCCTGGTCGAGAAATTGGCGTAATCGTCAGC
ATCGGTACAGGTTTACAAACCATCCCAGCTATAAGGCGTGGATTGCGTTG
GCTACCCTTCGGCCTTCATCGCGAATTGTCACTCGCGGGTGCCCTTGTGG
CGATGGCGACTAGCACGGCGAGAGTTGATAATGAGGTGCAGAGGATGTAT
AGGGATGCACAAACAGAGTATTACCGCTGGGATGTTGACTCGGGACTTGG
CGAGATTTCTTTGGAGCAGTGGATGAAGGAAGACGAAATGGGAAGTGTTA
CTAGGCGATACCTGGACGATCCTGATCAGGTTATACGCAGGCAGAAGTTG
GCTAGAACTATCGTTGGGATTTCGACTAAGAGGAGAGTTGTTGAGTGTTC
TGCTGGGAGGTTCACCGTCACCACAATCCCCGCAGGGGAAAAGGCTGCGA
GCTGGTCGTTAGAAAGCCTATCCCTTCCGGGCGTGCCCGGAAACAGCCGT
GCAGGTCCAATACCTGTCCTGGAAGACCTGGACCACGACGGCACCCGCGC
CGAGTCACAAATCCTAACCTGCAACCGCGCCCTCACTTCATCAGTAGACC
TCCGAACGCTAATTTCCGGCGTGCCCACAGGCCGTTACAAGGCCCGCTTC
ATCCTCCGCTCTTCGATACCCGTATCTTCGTCATCCCCCCTTCGCCCTCC
AGGCGACTTGATCCTCTCGGCCGGGAGACCTTACGATGCAAAGACGTTTA
CGAATCGCTTCGTCGATAGATACATTTCCTTGGACGTGGTTCCCGCGCTG
CTATACCCGGATGCAGCGAGAATTAGGGTTACCGCTCAGGAATGGGCTGT
GAGGAGTGAACAGAGTGGTAACAGCGGGTGGTTTGAAGTTTCTGGAGATG
CGGAGGTGGAGGTTTGTGCGGCTGGGTGTGTTGGGGTCGTGGTTAGCTGT
TTGATGAGGAATGGGGGGGATGGAGAAGGGGATGATGGGCAGATTTGTGG
TGCCAA

Sequences in the Contig:

SY0AAA34YA14FM1 SY0AAA39YC23FM1 SY0AAA3YI24FM1
SY0AAA41YF12FM1 SY0AAA45YH13FM1 SY0AAA57YB06FM1
SY0AAA61YM19FM1 SY0AAB44YE20FM1 SY0AAB60YK17FM1
SY0AAC44YC03FM1