Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1010
Length(NT) : 744
Best Gene Model Blast : Link to GSTUMT00006584001 E-value : 1e-116
Numbers of ESTs : 2

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001212976.1| Score: 152 E_value: 2e-08
KEGG Definition: hypothetical protein
Accession: ang:An15g06750 Score: 130 E_value: 3e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1010
TTGGCAGCGACGGGGTTACTGGGAGTACTGTTAAAGCAGGTTGTCAGCGC
ATTGCAGCCGATCCCAGATGAAATACTGAGCACATATGAGAAATCGAAGG
GGAGCGTTGGTGGCCGCAGACTCCAGCTACTCGATATCCTTAAAATGCTT
ATCAAGTCTCTGTCGCGCTTACAGAGGGGGTTTGTCTGTATAGATGCTTT
GGACGAGTTACCCGAGAATTCCCAACAAGGTCTTTGGGTTTCTTTACAGA
AGATAGTGCGGGAATGCCCAAACACCCGGCTATTTCTCACCGGGAGACCC
CACATACAAGGCAATGTACGGAAATACTTTCCCGGAACTGCTTTCCCGGA
ACTGCTGAGATGTTGGCGATAAGTCCGACCGAGCATGATATCGGGTTATA
TGTTGGAGATAGGCTGAGTAAAGAGTTCGAGAGTGGTGAGATGGACGAGG
AATTGGCAGCCGATATCCACAGAATTATTCCGGTAATCTCGGAAATATTT
CTCCTTGTCTCTCAGTTTGGGCGCGGTGCTCGCAGAGCCGACCATTCACC
TACGGAAGCGAGCACTTGATATGGTGACCAAGGGCCTCAGTTTTGACGGT
GTATACAGCAGGACATTAGAACGGATAAGACAGCTAGGTGGGAGCAAGGA
GAAGTTTTGAATAGGAGCGTTAATGTGGATTTCCCGTAGTGAGCGGCCCT
TGAAATGGGCGGAGTTATGCCATGCCCTGGGGGTAGAATTACGG

Sequences in the Contig:

SY0AAA12YA21FM1 SY0AAA3YI16FM1