Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig101
Length(NT) : 2092
Best Gene Model Blast : Link to GSTUMT00005405001 E-value : 0.0
Numbers of ESTs : 38

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001598922.1| Score: 2043 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: fgr:FG09940.1 Score: 2030 E_value: 0.0
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG0693 Score: 1989 E_value: 0.0
PFAM Definition: NAD_binding_5, Myo-inositol-1-phosphate synthase. This is a family of myo-inositol-1-phosphate synthases. Inositol-1-phosphate catalyses the conversion of glucose-6- phosphate to inositol-1-phosphate, which is then dephosphorylated to inositol. Inositol phosphates play an important role in signal transduction..
Pfam Number: pfam07994 Score: 1323 E_value: 1e-146
Swissprot: Q9FYV1|INO1_SESIN

Sequence:
>Contig101
TTGGCCAACTTTTTTGTACAAAGTTGTCCATCCCTCACACACTCGCACTC
GCACTCGCACTCGCACTCACAACCTCAGACATTTTCTCGCACACAGCCTT
ATCCAAACCTAATAACTCCACGAGACCATCACTCAACGAGTGTGGTCTAC
GAAAGTCGTCAAGACGTTCGCTACACTTCTTAACTCAGTTCACCACCCCC
ACCAAGGAGGCAAACGTTCTTCCCCTGCAGGAGGCGCCTCTGATTTGCCC
TACATCTCATAATCCCACTATTTCCGAAGTCACTACCACACTTGCAAATA
TTATGGCTCCTCACGCGAACGAATTTCCCAATGACCGTAGTGCAAATTCT
GCTGCCCCCAATGAATTGTTCACCGTCCGCTCCCCGAATGTCATCTATAC
CGAAGATGCCATCATGTCCACTTACACTTATCGTACTACTAAAGTCACGA
GGGCTGGCAACAAGTATGTCGCAGAGCCTCTGGAGACTGTATACGATTTC
AACGTCCAGCGTAAAATTGGCAAAGTGGGACTCATGCTCGTGGGATGGGG
TGGTAACAATGGAACTACTGTCACCGCCGGTATTATCGCTAACCGTGATG
GTTTGACCTGGGAAACCCGTGAGGGTACTAGGGGCGCAAATTATTACGGC
TCTGTTATCATGGGATCTACCATCAAATTGGGCAACGAGGCTGAAACTGG
GAAGGAGATTCATATCCCTTTCCGTGATATTCTCCCGATGGTTAATCCCA
ATGACCTTGTCCTTGGCGGGTGGGATATTAGTGGCATGAATCTTGCCGAT
GCTATGGATCGTGCGGCCGTTCTCGAACCCGATCTTAAGCGTCAGGTAGC
GAAGGAAATGCGCAACATGGTTCCATTGCCAAGTGTTTACTATCCTGACT
TCATTGCGGCCAACCAGGAGGATCGCGCCGATAACGTTTTGAAGGGTACC
AAGGAGGAACATGTCGAGAAGATTCGTAGTGATATCCGTAACTTCAAGGC
AGAGAACAACCTCGACAAGGTTATCGTTCTTTGGACCGCCAACACCGAAC
GTTACGCAGAGATCATTCCCGGTGTCAACGACACCGCTCAGAATCTTCTT
GCCGCTGTCAAGGCTGGCTACGATGAGGTTGCTCCATCTACTATCTTTGC
TATTGCTTGTATCCAGGAAGGTGTCCCTTTCATCAACGGTTCCCCCCAAA
ACACATTTGTCCCGGGCGCCATTGAGCTTGCCGAGCAACACAAGTCTTTT
ATCGGTGGTGACGATTTTAAGTCCGGTCAAACTAAAATGAAGTCTGCACT
GGTTGATTTCCTTGTCAATGCCGGTATCAAACTTACCTCGATCGCCTCTT
ACAACCATCTAGGAAACAACGATGGGAGGAATTTGAGCGAGCACAAGACA
TTCCGAAGCAAGGAGATTAGTAAGAGCAATGTTGTCGATGACATGGTGGA
GGCCAACTCCGTCTTGTACAAGAAGGGAGAGCACCCTGATCATACTGTAG
TCATCAAGTACATGCCTGCCGTTGGAGATTCCAAGCGCGCATTGGATGAG
TACTACGGTGAGATTTTCTTGGGCGGCCACCAAACCATCTCCATGTCCAA
TGTTTGCGAGGATTCCCTGTTGGCGAGCCCGCTCATTATCGATCTCGCGC
TTGTCGCAGAGCTCATGACCCGTATCACCTGGAAGTCTCACGCCTCTAAT
GGTGTTGGGACCAAGGATTACAAGGGTTTCCATAGTGTCCTCAGTATCTT
GAGCTACATGCTGAAGGCACCCTGTACTCCGCCTGGAACTCCCGTTATCA
ATTCTCTCGCCAAACAACGTGCGGCTATGTCCAACATCTTCCGCGCCTGT
GTTGGGTTGGACCCTGAGTCCGACATGACCTTGGAGCACAAGCTTTTCGC
TTAGGTCTTCAGGAATCCCGTTCTGAGCGGGAGATATTCTTCAGTTCTGT
GTGGCGTGGCTTGGAGGCGATGAATGGTGCTGTTTGAGTTGGCCTCCTTT
TCTATTGCTTTCATGCACAATTCTGTTTTCTGTTTTCTGTAACTTGAGCC
GTAGGGCCTAGTGATTTGTTTGCAATAAAACCCGTTCACACG

Sequences in the Contig:

SY0AAA10YP20FM1 SY0AAA12YA14FM1 SY0AAA13YP13FM1
SY0AAA14YE20FM1 SY0AAA16YI19FM1 SY0AAA17YL03FM1
SY0AAA18YC22FM1 SY0AAA18YC22RM1 SY0AAA18YP03FM1
SY0AAA18YP03RM1 SY0AAA20YG10RM1 SY0AAA22YG22FM1
SY0AAA22YP24FM1 SY0AAA23YJ15FM1 SY0AAA29YJ20FM1
SY0AAA2YO10FM1 SY0AAA35YE14FM1 SY0AAA3YI01FM1
SY0AAA45YH01FM1 SY0AAA46YH08FM1 SY0AAA47YM16FM1
SY0AAA53YF18FM1 SY0AAA5YA15FM1 SY0AAA62YE21FM1
SY0AAA63YG15FM1 SY0AAA8YP16FM1 SY0AAB16YD11FM1
SY0AAB1YD13FM1 SY0AAB22YD15FM1 SY0AAB24YL21FM1
SY0AAB25YL11FM1 SY0AAB34YL07FM1 SY0AAB38YO21FM1
SY0AAB39YG22FM1 SY0AAB42YN04FM1 SY0AAB46YH19FM1
SY0AAB57YD08FM1 SY0AAB60YB15FM1