Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1009
Length(NT) : 801
Best Gene Model Blast : Link to GSTUMT00003254001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_752402.2| Score: 534 E_value: 1e-52
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_1G10360 Score: 534 E_value: 5e-53
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3783 Score: 398 E_value: 1e-39
PFAM Definition: No Hit Found
Swissprot: P36114|YKZ8_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1009
TTGGCTTACAATTCTCCAGTACTATGGTAACATGGCTCAGTTCTCAGATA
TCACCCCCGACGACAACCATCCTTCCGGTATTGGGTATCCAGCCGATAGA
TGCCATGAGGCATTGGGGTGGATTAGAAGGCGGTATCCAAATGCTGCGCT
TTGGAAACTTGAGGAGGCGAGGATGGAGGCCGTTAAAGGCAACCTTGAGA
ATGCTGTGACGATGTTATCCGTTCCGGTTGTCACGCAGATGAAGCAGGTT
GAGGCATTGATACTATTTGAGAAATCTTTGAATCAGATGTTCCTGCACCG
ATATGAAGATGTTGCAGCCGGCTTCATCAAGCTTATGACACTAAATAACT
GGAGTCACGCTCTTTATAACTATTTTGCGGCCGTTTGCTACATTGAATTG
TATAGGCAAGCTAAGACTTCTGATACTGAAAAAGCGGAGGGCTGGGCTAA
AAAGGCAGAGGATTTGTTCGAGAGGATACCATCTTTCATGGGCAAGAAGC
GATTCATGGCTCAGGGTCTTCCGGTGGAAGTCTTTGCGGATAAGAAGATC
AAGAAATGGGTTGCTCGGTCCAAGGAGAGGGGCATTAGACTTGCCGATGC
TGTTGGTGTCAGCCCCGTTGAGGAGATGATGTTCTTCTGGAACGGGTACA
GACGAATGGACCAGGAAAATTTCGAGATATCCTTTCAGGCATTGCAATAC
TGGGGGGATCACGAAATGGAAAACGATACCATCGATGAGCAAGCTATTCG
CTGGCTCTTGCTCAGTGCAGTCATGAGGAATGCCGGGAAGTGGGAGAAAG
C

Sequences in the Contig:

SY0AAA3YI04FM1 SY0AAA8YM09FM1