Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1008
Length(NT) : 1761
Best Gene Model Blast : Link to GSTUMT00012106001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein CHGG_00781
Accession: ref|XP_001220002.1| Score: 317 E_value: 5e-27
KEGG Definition: hypothetical protein
Accession: ncr:NCU09315.1 Score: 314 E_value: 5e-27
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 120 E_value: 7e-07
PFAM Definition: No Hit Found
Swissprot: P20824|NUC1_NEUCR

Sequence:
>Contig1008
TTGGGGCAAAGTGCATCACAATGCCGGGGTCGGGAGCAGATGGGGTTCCA
ATCAAGTACAGATGCCTCATCGAACGAATCGGTATCTCCTGAGCCTCTAC
CGGAGGTCCTGATGGCGCCCCCACCACCTCGAAATGGCAATTCCCAATCC
CCACAGAATGGTCGATCAGACGATGGGTCGTCCACCTCAACAACACCTGG
AGCACCAGCAACCCCCGCGTCATTGATGAAGTTGACGAAGACGAATCTGC
CGACAGAAGATATCCCGCCAATAGCTATGGAGACTTCCGATTTCCTGAAT
GGCGACGTCGAGAGGGTAATGGCCGATGCTCCCCTGGTTTCCCGGAATGA
TAATGAAGCGGGAGGTGGAGGGGCAACTGCGATTATGGCGTCCCCGCATC
TTGATGCAGACAATCAATCAACGCCCACTATTGGAGCTAGCAAGACACCA
TCACTGAAGCCGGTGCCTTCATCAGGTAGTAGTGTCTCATCGGGGTCAAG
GCATGAAAGTCCGATAAACATACAGACGCCGGGCAGTGTCCTTAACAAAC
AAAGGGTTAACAAAAGTGGGACTAGTGGACGCGGGGGGAAACGGGGGAGC
GTTAGTTCGAGCCCTGGGCTACAGCCCAAGATTTCGCCAAGTATCAAGCC
TCTATTACCTTCAGGAATGACCCCCGAAGCGTCCACCCTCCTCCTGAAAT
CCAACTACCAAAACATTGTTGAGGGCACGCATAAGCAATTAGGTCTCTCA
TACCCAGCCGACCTCTCGACAAATCTAACCTCGAAACGAACATCACACAA
GATCGCTGAGCAGGGCCGTCGAAATAGAATCAATAACGCACTCACTGAGA
TCGCCTCCTTGTTGCCTCAAAAGGCCACTCCCTCTTCTTCCGGCGGGGGG
AGTAATTCCGATGGAGGAGGTGGAGGAGAGGGTCGGAGTAGTATTAATGG
TGGGGGTGGAGGAGGCGGCGGAGGAGGTAGTGCGGGCGCGGGACAGGCGA
GCAAGGCCAGTACCGTCGAAATGGCGATCGATTATATTAAGCAGTTGAAG
AAGGAGCTGGAAGATACGAAGGGTAGACTGGCCGATGCGGAGAGGAAGTT
GGGGGAGAAGGCTGGTGGGGAGAGCTGATCCTTCCTTCCGCCGGGCGGGG
GCTTTTTTACTTCTTTTTACCTTTTTATAATTATACCTCTTCTTGTCCCT
TCTTTCCCCTGTTCTCTTTTCCTTCTTTATGGGGGGGTTCTTTTTTTTTC
TTCGCTGGCCTAGGGATCCGCGGTATGGTGGAACAGTCAATGGAGGGGGG
AGGGTTTGGCTGGTGTGGCCATGCTCGGTTCGTATGCTGCGCTACGATTG
GAACAAAGAAAAAAAGGCCTCGGAATAGCTTTGCTTCGGAGCGGGTACGG
TGTTTTTCCTTTTTTTATCCATTTTACCCCATTTTCCATCTTGTCCCACC
ATATCTCTTACCACTTACTCTCCATCCATTCATCCTAGCATTTCCATTAA
AACTAACTAGTTGGCGAAACCCTTTTTTTGTTTTTACACTTTCCTTTTCG
AAGGTTGGTGTTAACTTGGGGAAAAAAAGAAAAAAAACCTATTTATTTAT
TTTTATTTACTTGTATGTATGTGTGTATGTATGGATGTGGGGATGGAAGG
AGGGATGCGTTATGTATGATGTTTAGGTGTAGGTATAAGATAGGTATGGC
GGTGAACTATGTTTTGTCGAGTCGTGTTGCACGCGAAGTACTGTTGAAGG
AAGGAGAATGG

Sequences in the Contig:

SY0AAA3YH23FM1 SY0AAB48YG05FM1 SY0AAB53YN11FM1
SY0AAC53YN17FM1 SY0AAD7YC07FM1