Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1007
Length(NT) : 921
Best Gene Model Blast : Link to GSTUMT00010854001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 463 E_value: 2e-44
KEGG Definition: hypothetical protein
Accession: ang:An12g05680 Score: 404 E_value: 7e-38
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 256 E_value: 5e-23
PFAM Definition: No Hit Found
Swissprot: Q92625|ANKS1_HUMAN
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig1007
TTGGTCCACTTTACCCTCCAGGAGTATCTCTCCGCTCATCCCAATATTTT
CAATAGACCTCACTCGACAATAACAGAAATCTGCTTGACATATCTAAATT
CCCAACATGTTAAATCCCTTTCGCCCGATCCCTCACCAATCACTCGGGAT
ACACCTTTTCTAGAATATTGTTCTATATACTGGGGGGTCCATGCGAAAAG
GGAACCCTCGGACTGCGCGAGATCACTTGCGCTGGAGCTACTTAAGGAGG
ATTATGGCCAGATATCCACTATATTTCTTTTATCACAAGTCAAGCATCTA
CCCTATGGGCGTGTTAATACTTGGTCTCCAATTAGTGGACTGCACTGCGC
ATCGTTCTTCGGAATCGCAGAGGTTGTGGTTGCATTGATAGATATGGGAT
GTGGCGATACCAGCGCGGAAGATCTCTTTGGATATACACCACTTGCATGG
GCGGCTCACAATGGACACGAGGAGGTGGTGAGAATACTCCTTGGGCAGGA
AGAGGCCAACACCGACAAAGCAGGTAATGATGGCCAAACACCTCTCGCTT
TGGCCGCTCGGAATGGACATGAGGGAGTGGTGAAAATACTCCTAGGGTGG
AGAGAGGTCGACCCCAACAAGTCAGGGCCCTACCACCAAACACCGCTCTC
GTTTGCCGCTGAGAATGGACATGAGGGAGTGGTGAAAATACTCCTAGGGC
GGGGAGAGGTCGACCCCGATAAACCAGATAATGACGACTTGACACCGCTC
TCGTGTGCCGCTTTGAGAGGCCATGAGGGAGTGGTGAAAATACTCCTTGG
GCGGAGAGAGGTCGACCCCGACAAGCCAGATGCCAACGACCAAACACCGC
TCTCGCTTGCCGCTTCGAATGGACATGAGGGAGTGATGAAATTACTCCTA
GAGCGGGGAGAGGTCAACCCC

Sequences in the Contig:

SY0AAA3YG24FM1 SY0AAB40YF01FM1