Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1006
Length(NT) : 594
Best Gene Model Blast : Link to GSTUMT00006859001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein MGG_03743
Accession: ref|XP_361200.1| Score: 564 E_value: 2e-56
KEGG Definition: hypothetical protein
Accession: mgr:MGG_03743 Score: 564 E_value: 9e-57
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1006
GCGTAAGATATTTATCGAGGGAAGAACGGCAAGCATATCTGGTCAAAATC
GACAACGAGGGGAGACTATGTTGGGCCAAAACTGGGAAACGCATAGATAC
CAGTACCAAATACAAAGACACACCCCACGGAATTGTACCTATAGATAGTC
CAGAAGCCGCTGAGGAGGCCACAGATGGTCAAAGATATCGCCCGGGTTCA
AGCAGCAGTATCTCTAGTTCGTCTTCATCTTCGTCATCGTCGTCCTCCTC
CTCCGGCTCCGACCAGAGCACAGTTGCAGACAGATATATAGATCCCAATA
TGGTTGCACATCATGGGCCTAAAAAGATTTTCCACGTTTCTGCGTCAACA
GTGCTCAACCGTTTGCTCCGTAAGACGACTAAGAAGAATACGTGGATTTT
TGTGGCAGATACTTCGTTCAGGCTCTACGTAGGAATCAAGCAAACAGGAA
CATTCCAGCATAGTAGCTTCCTGCACGGTGGGAGGATCAGTGCCGCGGGG
CTGATCAAGATCCGGGATGGCCAGTTGAGAGGCCTCTCACCGCTATCCGG
TCACTACCGTCCTCCAGCTGCTAACTTCCGCAGATTTGTCCATA

Sequences in the Contig:

SY0AAA3YF21FM1 SY0AAD10YJ01FM1