Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1005
Length(NT) : 1103
Best Gene Model Blast : Link to GSTUMT00006808001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SNOG_15891
Accession: ref|XP_001806026.1| Score: 991 E_value: 1e-105
KEGG Definition: adenylate cyclase AcyA [EC:4.6.1.1]; K01768 adenylate cyclase
Accession: afm:AFUA_6G08520 Score: 923 E_value: 6e-98
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0618 Score: 363 E_value: 3e-35
PFAM Definition: PP2C, Protein phosphatase 2C. Protein phosphatase 2C is a Mn++ or Mg++ dependent protein serine/threonine phosphatase..
Pfam Number: pfam00481 Score: 139 E_value: 2e-09
Swissprot: Q01513|CYAA_PODAN
Gene Ontology:
GO:0004016 = Molecular function: adenylate cyclase activity

Sequence:
>Contig1005
TTGGCAAGCCGTATCTCAAATACATTTGCTTTCTCCCTTCGGTATCTCCA
CATTGCAGATAACAAACTTTCCGATGAGGTCTTTGAGCAGCTGTCTTTGT
TGTCTGAATTGAGGATTTTGAACCTTTCCTACAACGAGATTTACGATATC
CCTTCACGAGCACTGAGTAGATTGTCGCTGCTCAACGAACTCTATCTGTC
TGGGAACGAGTTGACGAGTCTACCTGCAGAGGATTTAGAATATGTGGCGT
CACTTAAGGTGTTGCACATCAACTCTAACAAGTTCCAAACTTTGCCTGCA
GAACTTGGTAAGGTCAGGAAGCTATTGGTATTAGATGTTGGTAGTAATGC
CTTGAAGTACAATATTTCCAATTGGCCATACGATTGGAACTGGAATTGGA
ATTTGGACCTTAAGTACCTGAACTTGTCGGGTAACAAGCGTTTAGAGATT
AAGCCCGATCGAAGCGGCTCTGGTTCTGGACGCGGGCGTAGTATTACCGA
TTTTAGCCAGCTATCCAAGCTCCGAGTTCTTGGCCTGATGGATGTCACCT
TGACAATACCCAATGTACCTGACCAAACTGAGGATCGCCGTGTTCGCTTA
TCAACGTCGATGGTCCGAACAATGGCATATGGAATGGCTGACTCGTTGGG
GAGGAGTGAGCATCTATCGATGATTGATATGGTTATTCCAATGTTCCGTG
GGAATCGCAATGAATGTGTGATTGGGCTTTTCGATGGTCAAGCCCTCTCG
ACTGGAGGGAGTAAAGTTTCAAAATACTTGCATGAGCAGTTGGATACTTT
TCTAAAGGATGAATTGGAAAAGCTTCAGCCCGACGAGGAACCAGGACGTG
CTTTGCATCGTGCATTCCTCAACATGAACAAGGAGATGGCTACGGTGGCT
ATGCAGACAATAGATGAAAAGAATCTCACAGGAGTGGGCTCGCATCGGGG
ATCTACCGTTACTGGTGCATTTCTTGGTCCAGATGATCTTGTATCGGGCG
GATCAGCCACTGTAGTTTATATGAAAGGCAACAATCTCTACGTTGCTAAT
GTAGGAGATGCTACGGCTATGCTGGTTCAGTCGAGTGGGGAGCATGATAT
ACT

Sequences in the Contig:

SY0AAA3YF20FM1 SY0AAB60YA13FM1 SY0AAC48YK07FM1