Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1004
Length(NT) : 622
Best Gene Model Blast : Link to GSTUMT00003155001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SNOG_08526
Accession: ref|XP_001798837.1| Score: 157 E_value: 3e-09
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1004
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGTCAGTAAACTCCGAGCAC
TCGTCGATCACCTTAGTAGTAAGCTGGCTCAGCACGAATCTCACTCTGAA
GAAATCGAAATGCGCAAACAAAGTGAAGAGGCCGCCCTAGCCCACGCCGA
AAGGATCAGGATGAGATTACAGTCACGGGAGCAGGAGGCACAGGACATGA
AGCGCGGCTACGAGAACAAAATCCAAGAATTAGAGTCACGGATCAGCTCA
CTGTCAAATTCTCTGCCTGCCGCCCCTGGACAGGCTTTCCAGGAGATGAT
TGATAATGCCCTTTCGGCCACGAATGCTCGTTTCGCTTCATTAAGGAATG
AACACAACCAGCTTCTGAGCAGATATTACAATTTAAAGATCAAGTGTATC
AAACTTCAAGCGGATCGGGAGCTTTCAAACCTTCCTCCACATCACAGCAG
CCTTGACCATCATCAAACATCCCCTATGAGTCAGGGATTTAACGACTTGC
ACTCGTCACTCGCCCTCTCTGACAGTGAAGGTAGCCAATGCCATAGCCCG
CGTGGGGGTAACCACCTTTATCACTCGGAGGGGTCCACAAGCCCCCACTC
GGGCAGTTATCCTGAGTCGGCG

Sequences in the Contig:

SY0AAA3YF01FM1 SY0AAA45YO22FM1 SY0AAD48YI04FM1
SY0AAD48YO15FM1