Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1003
Length(NT) : 1825
Best Gene Model Blast : Link to GSTUMT00010358001 E-value : 0.0
Numbers of ESTs : 80

Blast Results:

Nr Definition: benzoate 4-monooxygenase cytochrome P450
Accession: ref|XP_001273845.1| Score: 1017 E_value: 1e-108
KEGG Definition: cytochrome P450 CYP3/CYP5/CYP6/CYP9 subfamilies
Accession: aor:AO090011000685 Score: 906 E_value: 1e-95
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG0158 Score: 507 E_value: 8e-52
PFAM Definition: p450, Cytochrome P450. Cytochrome P450s are haem-thiolate proteins involved in the oxidative degradation of various compounds. They are particularly well known for their role in the degradation of environmental toxins and mutagens. They can be divided into 4 classes, according to the method by which electrons from NAD(P)H are delivered to the catalytic site. Sequence conservation is relatively low within the family - there are only 3 absolutely conserved residues - but their general topography and structural fold are highly conserved. The conserved core is composed of a coil termed the meander, a four-helix bundle, helices J and K, and two sets of beta-sheets. These constitute the haem-binding loop (with an absolutely conserved cysteine that serves as the 5th ligand for the haem iron), the proton-transfer groove and the absolutely conserved EXXR motif in helix K. While prokaryotic P450s are soluble proteins, most eukaryotic P450s are associated with microsomal membranes. their general enzymatic function is to catalyse regiospecific and stereospecific oxidation of non-activated hydrocarbons at physiological temperatures..
Pfam Number: pfam00067 Score: 548 E_value: 2e-56
Swissprot: O13317|TRI11_FUSSP

Sequence:
>Contig1003
TTGGCTTCGAAAAAAGCCGGACCGCAACACACAGATTGGGGTTGATTGTT
TCTCTATACCACCATAAGTATCTTGTTGGCTCAGCTTCTTTGCCTTCAAG
TTCTACAATCATGATGGCCACATTGCACCGTTTCGAGGGTGCTGCCCTCC
TGGTGCAGCAAGTTGTCAAGGACGTGCCGGCGTGGAAGTTATGTGCTTAT
GTGACACTGTTGTTCCCACTGTACGCTATTACGATGGGGATTTACAATCT
CTTCTTTCACCCCTTGAGGAATTTTCCTGGACCGAAGAAGGCAGCTCTAT
CGAATATATGGTACTCGTATATATGGCTTAGCGGGAGGTACCCGCACATA
ATCCACGCTCTTCATGAGAAATATGGCTCCGTCGTCCGCGTAGCCCCGAA
CCAATTGTCCTACAACACCAGCTCCAGTTGGAAAGACATCTACACCAATT
ACGGCAATCGTCAAACCTTCCGCAAGAATAGCTTGTACGACAGAGACAAA
CTAGACCCTGTAACAAACATATCACGAGAGCCCGATCCCGTCAAGCATAA
CCAGATCAAAAGATTGTTTTCTAATGCGTTCTCAATGAAGTCACTTACTG
AACAGGAACCGATTGTGCAGGAGTATGTTGATTTACTAGTATCGCAGATT
GGAAAGCACGGTACCGGGGAGGATGGGTTGGACATGACCAAGTGGTATAA
TTATTGCACTTTTGATATAATTGGAGATTTAGCATTTGGAGAGGGCTTCG
ATGCTACAAAAGAAGGAAAACCTCACTTCTGGATCTCCCTAATCCTTGAC
AGCGTCTATGCCATCAGCTTCATAAATGTGACTGGTCGTTTCCCCTGGCT
ATCCAAGTTTGTCCCGTCAATCACCCCAGCAGAGATAGTAGAACGCCGCC
AGAGACACATCAATTATGGCCGCGACAAAGTCAACCGTCGCGTAAAATCC
GACAACAAACGCAAAGACTTTCTTACTAATGTCCTAGAAAACTATCGTGA
CCAAATTTCTGATGCAGAACTTTACTCGAACGCTCAAGTCTTCATCGTCG
CCGGCAGTGAAACCTCAGCCACAACCCTCTCAGGCCTAACCTACTACATC
CTCCGCAACCCACGCACCTACCAGCGCTTGGTCAGCGAGATAACCTCCTC
CTTCACGTCCTATTCAGAAATTAACTCCGTAACCGCCGGAAGGCTAGAAT
ACGTCGGAGCAGTAATTAACGAGACCCTCCGTATGTACCCGCCCGTCCCT
ATCGGTTTGCCAAGGCTCTCTCCGGGGGAAACTGTGGACGGGCAATTTAT
CCCTAAGGGCGCCCTGGTCAGCACGAGTCCGTGGGCTTCTGGACATTGTT
CAAAGAATTTTCACGATCCGTGGACGTTCAAGCCAGAGAGGTGGCTAGAT
GGGGAATGCGAAGAGAAAGATATTAGGGAGGCAAGTCAGCCGTTTTCGCT
CGGACCGAGAGGTTGCCTTGGGAGGAACTTGGCACTCATGGAACTGAGAC
TCATCATTTGCAAAATGCTTTTCACGTATCATCTAGAGTTGCTGGATACG
AAGCTGGATTGGGAGAGGGATAGTACTGCATATATCCTTTGGGTCAAGCC
GGATCTGAGGGTTAGGTTACACAGGAGATAATCTAGCTATCATAATATCA
TAGTTCGTTCGGGGAGGGAAATAGGATGGAATATCAATGGTCTTAGCTCC
CAAATGTTGGGGTTATCCAGCAACTTAAATTGTGTTATTTTCTTATTTGA
TTACAGATGTGTCCCAAATACTTTGTTCGTAGGTATGTATCATATTTCCA
AATATATTCCTATTTCCAAGACCAA

Sequences in the Contig:

SY0AAA1YP12FM1 SY0AAA27YB05FM1 SY0AAA34YB15FM1
SY0AAA37YG09FM1 SY0AAA3YE19FM1 SY0AAA3YF18FM1
SY0AAA3YK15FM1 SY0AAA45YL23FM1 SY0AAA45YM17FM1
SY0AAA48YL13FM1 SY0AAA5YE19FM1 SY0AAA60YL06FM1
SY0AAA60YN23FM1 SY0AAA6YN15FM1 SY0AAA7YD07FM1
SY0AAB17YH18FM1 SY0AAB17YI04FM1 SY0AAB22YN07FM1
SY0AAB29YC22FM1 SY0AAB34YN12FM1 SY0AAB36YI18FM1
SY0AAB37YL06FM1 SY0AAB41YL12FM1 SY0AAB42YL18FM1
SY0AAB55YG07FM1 SY0AAC10YM03FM1 SY0AAC11YN03FM1
SY0AAC18YK23FM1 SY0AAC19YM08FM1 SY0AAC19YP18FM1
SY0AAC24YP13FM1 SY0AAC27YP12FM1 SY0AAC28YD20FM1
SY0AAC31YB08FM1 SY0AAC31YI15FM1 SY0AAC32YG09FM1
SY0AAC33YC01FM1 SY0AAC35YC11FM1 SY0AAC35YO12FM1
SY0AAC42YA09FM1 SY0AAC42YI20FM1 SY0AAC42YO05FM1
SY0AAC45YG04FM1 SY0AAC46YI14FM1 SY0AAC48YA04FM1
SY0AAC51YN01FM1 SY0AAC54YG13FM1 SY0AAC56YF17FM1
SY0AAC57YK04FM1 SY0AAC61YO19FM1 SY0AAC62YC21FM1
SY0AAC62YG23FM1 SY0AAC6YF09FM1 SY0AAC6YL12FM1
SY0AAC9YM06FM1 SY0AAC9YO09FM1 SY0AAD11YD05FM1
SY0AAD12YA24FM1 SY0AAD15YK23FM1 SY0AAD17YD20FM1
SY0AAD19YP07FM1 SY0AAD20YN07FM1 SY0AAD23YO09FM1
SY0AAD25YF24FM1 SY0AAD31YL09FM1 SY0AAD32YK09FM1
SY0AAD36YG17FM1 SY0AAD39YA09FM1 SY0AAD41YL03FM1
SY0AAD42YB24FM1 SY0AAD46YN14FM1 SY0AAD47YL18FM1
SY0AAD4YN03FM1 SY0AAD53YK16FM1 SY0AAD59YK11FM1
SY0AAD62YL02FM1 SY0AAD63YN06FM1 SY0AAD6YC13FM1
SY0AAD6YE19FM1 SY0AAD9YF19FM1