Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1001
Length(NT) : 790
Best Gene Model Blast : Link to GSTUMT00007703001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001211249.1| Score: 895 E_value: 1e-94
KEGG Definition: DNA ligase, putative [EC:6.5.1.1]; K01971 DNA ligase (ATP)
Accession: afm:AFUA_5G12050 Score: 869 E_value: 7e-92
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG0966 Score: 640 E_value: 1e-67
PFAM Definition: DNA_ligase_A_M, ATP dependent DNA ligase domain. This domain belongs to a more diverse superfamily, including pfam01331 and pfam01653..
Pfam Number: pfam01068 Score: 199 E_value: 2e-16
Swissprot: Q4WVG8|DNL4_ASPFU

Sequence:
>Contig1001
AGAGCGCTGGTGATTTTGCGCTTCGCTGTTATGAGATCATCAGGAAACGG
CCAATGCGTACAACCCCTGGAAGCCTGACGATTTCTCAGGTAAACTCTAT
GCTAGACCGTCTCTCGCTGGCCAGTAAAGAGGAGGAGCAGCTTCCAATAA
TGACTGAGTTCTACAACAACATGAATGCCAGCGAGCTAATGTGGTTGATT
AGGATCATAATGAGACAAATGAAAGTTGGTGCCACCGAAAGAACCTTCTT
TGATGCCTGGCACCCCGATGCCGCTGCTCTCTTCAATATATCATCGTCAC
TCAAGCGTGTCTGCTGGGAACTCTCGGATCCCGAGTTCCGCATGGACTCT
GATGGCAAGTCGGTATCTCTAATGTCATGCTTCCAACCGCAACTAGCTCA
GTTTCAGAAACGCTCGTTGGACGACGCCGTCAAGGCTATGCATCTTACTC
CTGAAGACCCCATTTTCTGGATTGAAGAAAAGCTAGATGGCGAGCGGATG
CAAATGCATTACGAGAACGGCAATTTCATGTTCTGGAGTCGCAAAGCTAA
AGACTACACGAGGCTTTATGGCTCCTGTTTCGATGATGGGAGCCTAACGA
GACACCTTCGCGGCGCCTTCGACGATGGCGTTAAAAGCATCATCCTGGAC
GGTGAGATGATTACTTGGGACCCAAGATTGGACTGTATAGTTGCCTTTGG
AACACTTAAAACCGCAGCGCTTGAAGGGATCAGGAACCCGTTTGGTGATG
GCCCTCGGCCTTTATGTAACTATATCATCTACCTTGCTTA

Sequences in the Contig:

SY0AAA3YE15FM1 SY0AAB14YL15FM1