Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1000
Length(NT) : 618
Best Gene Model Blast : Link to GSTUMT00011571001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein CHGG_00516
Accession: ref|XP_001219737.1| Score: 457 E_value: 5e-44
KEGG Definition: hypothetical protein
Accession: fgr:FG10037.1 Score: 452 E_value: 9e-44
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3087 Score: 513 E_value: 4e-53
PFAM Definition: Kdo, Lipopolysaccharide kinase (Kdo/WaaP) family. These lipopolysaccharide kinases are related to protein kinases pfam00069. This family includes waaP (rfaP) gene product is required for the addition of phosphate to O-4 of the first heptose residue of the lipopolysaccharide (LPS) inner core region. It has previously been shown that WaaP is necessary for resistance to hydrophobic and polycationic antimicrobials in E. coli and that it is required for virulence in invasive strains of S. enterica..
Pfam Number: pfam06293 Score: 120 E_value: 2e-07
Swissprot: Q2HGY8|BUD32_CHAGB

Sequence:
>Contig1000
TTGGCCGAAATGAGCTCAACAGAAATCGACCCCCCAACTCCCAAATTCCT
CATCAAACAGGGAGCTGAAGCGCTAGTCTACCGCACAACCTACCTCCTCC
CACACATCCCTGCGCTGCTAAAACACCGTCCGTCGAAACAATACAGGCAT
CCAACCCTCGATGCACGCCTCACAAAACATCGCTGTCTTTCCGAATCCCG
CCTCTTGATCCGCGCCCGCTCCCTCAGGATCCCGGTTCCGGCGGTGTACT
TTGTCGACGAGAGTCGCGGGGAGATATTTATGGAGTGGATTTCGGGGAGT
TCTGTCCGGGAGGTGCTGGATGAGGTCCTTGCCCAGGAGGGTGGGGAAGC
AATGGTTGACCGAATGATGGTTAAGGTTGGCGTAGCGGTGGGGGCCTTGC
ATGCGGCCGACATTGTGCATGGGGACTTGACGACCAGCAATATTATGGTT
CGGAACGGTGAGGGTGAGGGGATTGTGGGATTCGGAGAGAAGGAGGTTGT
GTTGGTTGATTTTGGGCTTGGAACTGTGTCTACGCAGGACGAGGATAAGG
CTGTCGATTTGTATGTTCTTGAGAGGGCATTCACTAGTACGCATCCAAAA
GCGGAGAAGTTGTTCCAT

Sequences in the Contig:

SY0AAA3YE03FM1 SY0AAA44YA15FM1 SY0AAB29YD21FM1