Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig100
Length(NT) : 1240
Best Gene Model Blast : Link to GSTUMT00001027001 E-value : 0.0
Numbers of ESTs : 23

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig100
TTGGTGGAAATCTCTCGCGATCCTTCCCCCTCTTCGTTCACCGTCTGTTC
GTCCCGGCCACCCCCCTCCCCTTATACTCCTTCACAATCCCTCCAACGGG
ACCCGATTGAAGGATTAAGACAATCAGGATAGTAAAATAAAGTAAAAAAT
AGAGTCGGGAGGAAAATAGGGACGCTCGAAATGTGGTTCAACCCCCTCTC
AGCCGCACTCCTCTATGGACTACTGTCAACAACCATCGTCGTCGCGCAAA
CCGGTCTTCCCACGGGTTTCCCTCCTGCGAGCGCCTCTGCTATGGATACT
CTCAGCCCGGCGTCGACAGCGTCGCAGGGCCAGGGACTGAAGGGGGGCAG
CGGGACCGGAAATAATCGTAACTTAAAGGAAGGGGCATCCGCTATGGATA
CGGCTGCTCAGGGTTCCACTACCCCCACCGCTGGCTCTGCTCGGCCATCG
TCAGCAAAGAGTTCCAGTAATACTGGAGCTATAGCTGGAGGAGTTATCGG
CGGGGTGCTCTTCCTATTGCTTGTTGGCGCTTTGTTATTATTTTTGAGGA
AAAGGAGGAGGACCCGTGATCAGTTTGGTTCTGAGGAGAAATCTGCCGAC
GAAACGGCGGCCAACTACGACGGCCCATCCCTCCCCCCCGTCCCTCCCGC
CGCAGCTTCGGAGTCACCCCACCCTCATCACAGCCCGGCAGCTCCGAACG
AAGCCCATGCTTTAATGTCCCATTACGGCGACACACAACCACAGCAGATG
CCCCAGGAAGTCCAACCAGTCATCATGCCGGCCAAGCCATACGACGTGAA
CTCCTCGTCTCGCGAAATTCGTGGTAGTGATGAAGACGATGACGGCGTCT
CGATCAATAGTCCTTCACCGGTAACTACGCCAAGTCCCGAACGACAGCAG
GAACAGCAGAGGAGTGTGCCGAGATTGCCGATTTATCAGGGAGGAAGGAG
GGACGACGTCGGGGGGGATACACCGCCCCCGGCATTATAATGTTTTGGTC
GGTTGGTGGGTTGTGGCGAGGAAAAAGAGGTGGGGGGAAATGTATTCATT
TTTAACTATTTTTTTGTATAGGATTGTATTCGAATGATTGGAGTGTCGAT
CTTATTCTTTCTTGACGCTCATTTTTTGCTGGATGGGAGATGGTGCTACT
GAATTTACTTATTTATTTAGTTCCCGAGTTTTTTTTTTTTACTTTTCTTT
TGGACACTTGACGAAGGTATGATACGCCATTTACTGTACC

Sequences in the Contig:

SY0AAA12YI15FM1 SY0AAA13YO14FM1 SY0AAA16YO21FM1
SY0AAA1YM21FM1 SY0AAA23YA24RM1 SY0AAA31YC21FM1
SY0AAA43YD23FM1 SY0AAA4YL21FM1 SY0AAA54YC05FM1
SY0AAA61YG15FM1 SY0AAB14YH07FM1 SY0AAB19YL09FM1
SY0AAB1YK24FM1 SY0AAB21YG01FM1 SY0AAB36YD23FM1
SY0AAB44YM07FM1 SY0AAB47YM09FM1 SY0AAB53YA20FM1
SY0AAB53YN03FM1 SY0AAB5YJ07FM1 SY0AAB5YO20FM1
SY0AAB8YH02FM1 SY0AAD23YM11FM1