Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig10
Length(NT) : 1525
Best Gene Model Blast : Link to GSTUMT00008647001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: rna-binding protein
Accession: ref|XP_001270772.1| Score: 585 E_value: 3e-58
KEGG Definition: G-patch domain protein, putative
Accession: afm:AFUA_3G07480 Score: 582 E_value: 3e-58
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0147 Score: 123 E_value: 3e-07
PFAM Definition: No Hit Found
Swissprot: P87143|YDMD_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0000398 = Biological process: nuclear mRNA splicing, via spliceosome

Sequence:
>Contig10
TTGGAACTACTTCAACATCTAGACACAACACAATATCCCGCGTATATACT
CATTGCGCACCACGGATTACTGATGGCCTACTATCAGCAACCGTTATCAC
CCCAGGGAAGATACAAGGAAGACCAACACGAGGATCCTTACTATGCTGAT
CGCCCGCACCGCCAAAACCTTAGCGTCCGAGACCACGAGCGGGACCGGGA
TGCCCCCAGAGGACCACGAGGCTATCACCAACAACACTCAGGCTACCGGT
CGCGCTCCCGATCCCGTGACAGAGCACGCAGCCGCGGGCGGGAGCCAAGA
GGAGGAGGTTACTATGATCGCGATGCTCCTCGTTCCAGAAGCGGGAGCAG
GGATCGAGAGTGGTACGGGGGACCAGCAAGCAGAGATGTCATAATAGAGG
GACTTGGGCCGGAGATGGATGACGAATACGTTGTTAACCCTCCCCTTTGG
ACTGATGTGCCAATACTTTGGGCATTATCACCCATCATCACCACACTTAC
CATCGTCACCCTGATTTTCACACAGCTTGACTGTTTTCTCTTTTTTTTGT
CTGCGCATTTTTTAGATGGACCTCTGCTGAAAGTTTGGCCTGGGGGGTCT
CTTACGGCCGTCGAGGGGATTGCAGATTATAAATGAACTTAGACATGAAC
TGCATGTTGAGGGTATTGAAAAAGTAGCTGTCATTAGGGAGCGAAAAACT
GGCATATCACGGCAGTTTGCTTTCATACACTTCACCACAGTTCAACAGTC
CAGGGCCTTTTTGGAGCAGTATTATCCTACTGTTAGTTTAGGTCCTTCAG
CTGATAGATGTCGTATTGCCTTTTCGAGAGAACGCGATGAAAGCGATCGG
AGAAGCCGCAGGCGAGATGACGAAGAAGAATGGAAATGCAGAGTTTGCCT
TCTAGTAAATTACCCGCGCCGTCAGGAGTGTTTCCGCTGTCAAACTCCAA
AATCAGAGTTAAGTGTCACCGGGACTTTGACTCACCCTACTCCTACACAC
TTCACCAACGATGGGGAGCGTGATATGGCTGCATCGCCACCCTCTCAATT
CCTCTTGTTCCGCAACCTTGAGTCTTCGGTGAATGAAGAGCTCCTTGCCA
AGGGAGCCCTCAAACTCACGATTCCGAATTCCGAAACTCCCGAAACGTCA
AAAACTGGACCAATCGGTGCAAAAGAATCCTCCTTAAAACGTATTTTACT
TGTACGCGACAGAAAGACAAATGAGTCTTGGCGGTACGGGTTCGCTGAAT
TCTCGACAGCATCCGATGCCCAGGCCGCATTGGCTGCCTACACCAAAGTG
GAGAAGTTTACCATTAGCAGCAAACCTGTTACTGTATCTTACATACATCC
TGGGGTCTTTGTACCAGTCTACAACGCGCCAAAAGGTGCGGACAAATTCA
CGTTTACTGCGATGAGTGCGCACGTCGGCAATGGGCTGAGATTAGCATAT
TGGGACGATGATGGATTTGTCTCCGAGCACACAGTATCAAAGCCGGAGGA
AACCAGCGTTGGATCAGATGACGCA

Sequences in the Contig:

SY0AAA10YD09FM1 SY0AAA38YH04FM1 SY0AAA48YO09FM1
SY0AAC13YO01FM1 SY0AAC1YK19FM1 SY0AAC2YH17FM1
SY0AAC38YB03FM1 SY0AAD19YA19FM1 SY0AAD51YC11FM1