Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1
Length(NT) : 1107
Best Gene Model Blast : Link to GSTUMT00005955001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein CIMG_09443
Accession: ref|XP_001239822.1| Score: 500 E_value: 1e-48
KEGG Definition: hypothetical protein
Accession: ani:AN7297.2 Score: 467 E_value: 5e-45
KOG Definition:
Classification: [Chromatin structure and dynamics, Transcription].
Kog Number: KOG1649 Score: 223 E_value: 5e-19
PFAM Definition: SNF5, SNF5 / SMARCB1 / INI1. SNF5 is a component of the yeast SWI/SNF complex, which is an ATP-dependent nucleosome-remodelling complex that regulates the transcription of a subset of yeast genes. SNF5 is a key component of all SWI/SNF-class complexes characterised so far. This family consists of the conserved region of SNF5, including a direct repeat motif. SNF5 is essential for the assembly promoter targeting and chromatin remodelling activity of the SWI-SNF complex. SNF5 is also known as SMARCB1, for SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily b, member 1, and also INI1 for integrase interactor 1. Loss-of function mutations in SNF5 are thought to contribute to oncogenesis in malignant rhabdoid tumours (MRTs)..
Pfam Number: pfam04855 Score: 219 E_value: 1e-18
Swissprot: Q09699|YA28_SCHPO
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus

Sequence:
>Contig1
TTGGGAATCTGCAGATACTGCCCTCTCTGCCTCCGCCCTCCGTTTCCCGC
ATACCAAATACTCTTCCCGGCACGAAAGCTTAATTTCGCCCATCCCATCC
CATCATATCTCGCCCTCCCATTGCTTGCCCACTGACCCACCATATCCTAT
TCTATCGCCTCGCGCACCCGTGCTCCCCCGCCACGCTGAGGCAGGCGGTC
TCTCCCCTAGAACTATCGGCATTTTTTCCTCCCCCAGTCGGTTCATCCGT
CCCTCCATTATGCCAGACACCTCTCTCCCTCAGTCCCCCCAACTAGATCA
CCAGCAGCCCCAGAAGACAGCCGCATCACTCCCATCATCACTTAAAGAGT
CGCTCGCCGCATCCACATCGCCTACATCACTCCCATCGTCACCCACCACT
GTAAAATCCGCATCTGGGGGCGCCGGAGGTGACGCGCCAGACCAGAAGCC
ATCGCAACTTAAAAACAAGGGCAAGGCTGTGCAGGACCAAACAGATTCGG
ACTCGTCCGAAGTGAAGTCCCTCAAGAGACGACCATCGACTTCAGCCCTG
TTGCTCGACCAATACATCACACGCGATCATCTACACGCGGCTGCGATATT
CACACAGACTGAGGCTTCCAACAACCTTATCCGCTCCAAGCGACGCGAAG
TAGATTATTATCAGCAGCTTAGACGCGAACGCCAGGTTAATCCAGGCGCG
GTATTTGGGTACGGTTACCAAGGCTATGGAAATGGATTCACTGATGGAAA
GTCGCGAATTTTGTATCCGTGTCAGCGAAAGAGGCCGGGTGGGAGGAAAG
CGCGAGAACTGCGATTATCTCGGTCGCAGCTTCAGACGCAGGCGGATATG
GTGGAATCGTTGGTTCCTGTGCGACTCGATATCGATTATGATAAGATCAA
GCTTCGGGATACATTTACATGGAATATGCATGACCGATCAATACCGCTTG
AGCTCTTTGCCGAACAGTTGGTTGAGGATTTTCACCTCCCTCTAGCCCCT
GCGCTTGTACAGATGGTGGCCAATTCAATTCGGGAGCAGGTTACCGATTA
CCATCCCCACGTTTTCTTTGCCGATGATCCGCTAGATCCGACCCTACCCT
ACACAGC

Sequences in the Contig:

SY0AAA10YA07FM1 SY0AAA21YP10FM1 SY0AAB24YA08FM1
SY0AAB48YI08FM1